Week 3 Blog

Week 3: Analogy/Homology Blog Post

1. For your homologus traits provide the following information (25 pts):
   1. Briefly describe the two different species that possess the homologus trait. (5 pts)
      - Two different species that possess the homologous trait are: An ape, the arm being the homologous structure, and a human, with the arm being the homologous structure also.
      
   2. Describe the homologus trait of each species, focusing on the differences in structure and function of the trait. Why do these homologus traits exhibit differences between the two species? Make sure your explanation is clear and complete. (10 pts)
      The homologous trait of these two would be the arm. They differ in structure because of evolution and how they are intended to be used.
      
   3. Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologous trait? (5 pts)
      The common ancestor of the two are african apes. 
      
      
      
   4. Provide an image of each species in this comparison. (5 pts)
      pandathumb3.gif
      
      
2. For your analogous traits provide the following information (25 pts):
   1. Briefly describe the two different species that possess the analogous trait. (5 pts)
      Two species that possess the analogous trait are: a shark and a dolphin. The analogous structure would be their fin.  
      
   2. Describe the analogous trait of each species, focusing on the similarities in structure and function of the trait. Clearly explain why these analogous traits exhibit similarities between the two species. (10 pts)
      the analogous structure of the fin is similar on both the shark and the dolphin. They are similar and both serve the function of stability.
      
   3. All pairs of organisms share some common ancestor if you go back far enough in time. Could the common ancestor of these two species have possessed this analogous trait? How do we know these traits are analogous and not genetically related from common descent? (5 pts) We know they are analogous because they do not share the same ancestor. 
      
   4. Provide an image of each species in this comparison. (5 pts) 
      sharkordolphintxt1.png
      

DNA CODE

ATTGTACTAAGCAAGTGCTAACGGACGGCCATGCAGTTTGATCGCCG

Darwin

   One can argue that Alfred Russel Wallace had a tremendous impact of Charles Darwin, and perhaps was Darwin's greatest influence in the theory of natural selection. While there are others that indeed helped Charles and his theory, it was Alfred Wallace who helped him to come out and share his theories with the world by publishing his findings on natural selection. 
    Alfred Wallace made a huge impact on the field of science and what we know about species all over the world and evidence that evolution is taking place. It was mentioned that Alfred was perhaps the greatest collector of natural history specimens. This passion that he had for different specimens all over the world and the data that he collected provided science with a new field of study that is Evolutionary Biogeography. He made excellent discoveries in the evolution of different species all over the world during his land surveying explorations, which also helped give accurate maps of the Amazon and later on, the rest of the world.  
   During the explorations of Wallace he began to notice barriers that separated different species and began to see that these barriers were actually affecting the way those species evolved. On one of his land surveying trips he noticed that the Amazon river was a huge barrier and the species on one side or another were completely different. He began to notice and take note of these different traits that were happening due the different environments.
   Is it possible that Darwin could have made the same theory with out the help and correspondence of Alfred? He very well could have made the discovery with the info he received but there is no doubt it would have taken years and years longer to acquire the same info and data that Alfred had collected. Charles and Alfred came up with almost an identical theory, so it was clear Darwin already had the idea of how natural selection worked but it was Alfred who provided Charles with the data and collections that he came across. It would be unfair to over look Alfred Wallace and his contributions to Charles Darwin that help lead to his discoveries.
   The attitude of the church played a huge role on the decision for Darwin to release his findings. It was almost 20 years after his discovery that he made the decision to go ahead and publish his book on natural selection. If it wasn't for the motivation and support of Alfred it may have never been published. 

http://www.pewforum.org/2009/02/04/darwin-and-his-theory-of-evolution/