Human Variation

1. Select only ONE of the following environmental stresses: (a) heat, (b) high levels of solar radiation, (c) cold, or (d) high altitude. Discuss specifically how this environmental stress negatively impacts the survival of humans by disturbing homeostasis. (5 pts) High altitude negatively impacts homeostasis due to its low air pressure, and  low humidity. The lower air pressure makes it harder for our boys to take in the oxygen we need. The low humidity raises the chances of dehydration. 
2.     2.    Identify 4 ways in which humans have adapted to this stress, choosing one specific adaptation from each of the different types of adaptations listed above (short term, facultative, developmental and cultural). Include images of the adaptations. (5 pts each/ 20 pts total) Short term adaptations to high altitude would be rapid heart rate and breathing. This allows the body to receive the oxygen it needs.
   
   Facultative adaptations of humans to high altitude is our body creating more red blood cells.
   
   Developmental adaptations would be the increase in lungs and lung expansion.
   
   Cultural adaptations would be retaining low levels of haemoglobin.  
   
3. What are the benefits of studying human variation from this perspective across environmental clines? Can information from explorations like this be useful to help us in any way? Offer one example of how this information can be used in a productive way. (5 pts) The benefits of studying human variation based on environmental clines is that it in info based on scientific studies of genes, this ensures accuracy. Absolutely this info can useful and help us in many ways. This is useful is by examining the genes of people that live in different environments to get an accurate idea about how we actually adapt to the human stresses. For example looking at the genetics of someone that lives above so many thousands of feet above sea level and what it is that allows them to survive. 
   
4. How would you use race to understand the variation of the adaptations you listed in #2? Explain why the study of environmental influences on adaptations is a better way to understand human variation than by the use of race. (10 pts) The way I would use race to explain the adaptations would be that one particular race is can adapt better because their home region sees more of those conditions vs the home land of someone else. Environmental Influence is much better based on the accuracy of the results it provides. There is more of a scientific process to coming about the information.
   
5. Respond to two other students’ posts with substantive comments by Wednesday of Week 7, no later than 11:59 pm. (5 pts each/ 10 pts total) 

Language Assignment Experiment

Justin Shepherd

3-24-15P

• • 
      Did you find this experiment difficult or easy? Explain. (5 pts)
    1. I found this experiment to be a tad difficult but after coming up with an activity I could apply this to it made it a tad bit easier. What I decided to do is show my friend ( without words) how to do a transmission flush on a car. I did this with out words by pointing to everything needing to be removed, where the tools were, how much fluid etc etc. I found it to be a lot easier doing this than just sitting down and having a face to face conversation.
    
  •   What were the impressions of partners in the conversation? Did they alter their way of
    communicating with you because of your absence of symbolic communication? Describe. (5 pts)
    2. The impressions of my partner during this experiment was somewhat normal. Outside of the Experiment we are pretty good at communicating with-out words so he did not have to alter much of his communication. Most questions were able to be answered by a head nod or shake, other answers could be pointed to or physically shown.
    
  •   Imagine that you and your partners in the conversation represent two different cultures meeting
    for the first time. Which culture has the advantage in communicating complex ideas? What attitudes might the speaking culture have toward the culture that does not use symbolic language? Identify individuals in our culture that have difficulty communicating with spoken language and explore how that affects how those who do speak interact with those individuals. (10 pts) 
    3.  The culture that has the advantage is the one that is able to listen to words being spoken. Language is a very important part of communication so to understand it is a huge advantage. The attitude of the speaking culture could be different, if there is an understanding about something and there is patience than attitudes can be positive. On the other hand it could be very frustrating.
    
       
  
  
  
  
  
  
  
  
  
  

  
  

  
  
  
  PART 2
  
  
  
  
  
  
  
  •   Were you able to last for the full 15 minutes of using only speech for communicating? What made this experiment difficult for you? (5 pts)
    While it was a bit awkward at times I was able to last the entire 15 minutes using only speech. What made this difficult was trying to adjust to not moving and making 15 mins of eye contact. Normally there is a lot of body movement and hand signals involved in a conversation so it was a tad different not being able to do those things. 
    
  •   How were your partners in this part of the experiment affected by your communication limitations? Explain. (5 pts)
    My partner reacted normally for the most part, being there was a lot of questions involved it made it easier. 
    
  •   What does this experiment say about our use of “signs” in our language, i.e., how important is non-speech language techniques in our ability to communicate effectively? (5 pts)
    This experiment shows that hand signals and body language is a huge part of conversation, most of the time people don't even notice their body language but when one tries to not use any, it becomes apparent how important it is and how hard it can be to not use. 
    
  •   Are there people who have difficulty reading body language? Describe the adaptive benefit to possessing the ability to read body language. Can you describe environmental conditions where there might be a benefit to not reading body language? (5 pts)
    
    Yes, there are indeed people who have difficulties reading body language. Being able to read body language can go a long ways if you don't understand the verbal language being spoken. If you are not quite sure about something i wouldn't rely solely on body language to come to an understanding. One might not understand the body signals and get the wrong impression. 
    
  
  

   

  
  
  

   

  
  

   

  
  



 





 





 





 





 




 




  





 





 




 




 

Piltdown Hoax

1. Begin by giving a brief synopsis of the Piltdown hoax, including when and where it was found, by whom, its scientific significance (what would it have taught us) and varying effects this had on the scientific community. Also include how the hoax was discovered and the varying responses it received from the scientist(s) involved and in the related fields of human evolution. (10 pts) 
   

   1. The Piltdown Hoax was a forgery in fossils that took place in the early 1900's. In a town called Louis in Southern England a man named Charles Dawson started this whole scam many years after  a worker found a piece of a skull in the Piltdown gravel pit. For sometime after Dawson and a man named Arthur Woodward continued to dig up different bone fragments. They claimed the fossils appeared to be that of an early human being. This would lead researchers in the wrong direction for 40 years until the truth comes out.  The path to finding out the truth to human evolution would turn in to a dead end. Had this been the truth like everyone was fooled into believing it would provide an answer to our relation to apes. The finding of this would lead others to conclusions that would all turn out to be false. The hoax was discovered in 1970 when a trunk was found that contained fossils that were modified and looked similar to that of the Piltdown findings. It would soon be uncovered that many of Dawson's finings were in fact fake or forged.  Scientists at that time were already in doubt of the findings are thought that perhaps they were from different creatures. Another factor was that since the Death of Dawson there were never any more fossils found like his.

Scientists are curious, creative and persistent by nature, but being human, they also have faults. What human faults come into play here in this scenario and how did these faults negatively impact the scientific process? (5 pts) 

2. The human faults that come into play here are competition and the ability to be deceived. Competition is at fault because after Germany made a claim of humans originating in Germany the hoax was then started in England to draw peoples attention for years. The way this impacted the scientific process was by  revealing that science can't be real if there is possibilities for things to be fake. I think this impacted the field and encouraged them to test all findings to make sure there was no possible chance of something being wrong.

What positive aspects of the scientific process were responsible for revealing the skull to be a fraud? Be specific about scientific tools, processes or methodologies that were involved in providing accurate information about the Piltdown skull. (5 pts) 

3. What reveled this hoax was other findings through out the world. None of these findings would ever match that of Dawson's findings. A series of tests were done on the fossils during the mid 1900's, one of these tests was a fluorine test, which showed that the fossils were no more than 100 years old. After their testings they were able to conclude that the fossils indeed came from two different creatures, A human and of an orangutan. They were able to see that bones were staged different colors and teeth were gridded  down. 

Is it possible to remove the “human” factor from science to reduce the chance of errors like this happening again? Would you want to remove the human factor from science? (5 pts) 

4. I think to a certain extent it is possible to remove the Human factor from science. What i mean is if there is a certain series of steps that are required to test and validate things than it should be impossible to come up with incorrect answers. I believe the human factor has already been removed from science based of the way the scientific process works.

Life Lesson: What lesson can you take from this historical event regarding taking information at face value from unverified sources? (5 pts)  

5. What I learned from this was to never believe something just because someone said it was that way. In order for it to be the truth it needs to be tested and prove to be impossible to be wrong. I try and imply this in many aspects of my life. 

Week 3 Blog

Week 3: Analogy/Homology Blog Post

1. For your homologus traits provide the following information (25 pts):
   1. Briefly describe the two different species that possess the homologus trait. (5 pts)
      - Two different species that possess the homologous trait are: An ape, the arm being the homologous structure, and a human, with the arm being the homologous structure also.
      
   2. Describe the homologus trait of each species, focusing on the differences in structure and function of the trait. Why do these homologus traits exhibit differences between the two species? Make sure your explanation is clear and complete. (10 pts)
      The homologous trait of these two would be the arm. They differ in structure because of evolution and how they are intended to be used.
      
   3. Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologous trait? (5 pts)
      The common ancestor of the two are african apes. 
      
      
      
   4. Provide an image of each species in this comparison. (5 pts)
      pandathumb3.gif
      
      
2. For your analogous traits provide the following information (25 pts):
   1. Briefly describe the two different species that possess the analogous trait. (5 pts)
      Two species that possess the analogous trait are: a shark and a dolphin. The analogous structure would be their fin.  
      
   2. Describe the analogous trait of each species, focusing on the similarities in structure and function of the trait. Clearly explain why these analogous traits exhibit similarities between the two species. (10 pts)
      the analogous structure of the fin is similar on both the shark and the dolphin. They are similar and both serve the function of stability.
      
   3. All pairs of organisms share some common ancestor if you go back far enough in time. Could the common ancestor of these two species have possessed this analogous trait? How do we know these traits are analogous and not genetically related from common descent? (5 pts) We know they are analogous because they do not share the same ancestor. 
      
   4. Provide an image of each species in this comparison. (5 pts) 
      sharkordolphintxt1.png
      

DNA CODE

ATTGTACTAAGCAAGTGCTAACGGACGGCCATGCAGTTTGATCGCCG

Darwin

   One can argue that Alfred Russel Wallace had a tremendous impact of Charles Darwin, and perhaps was Darwin's greatest influence in the theory of natural selection. While there are others that indeed helped Charles and his theory, it was Alfred Wallace who helped him to come out and share his theories with the world by publishing his findings on natural selection. 
    Alfred Wallace made a huge impact on the field of science and what we know about species all over the world and evidence that evolution is taking place. It was mentioned that Alfred was perhaps the greatest collector of natural history specimens. This passion that he had for different specimens all over the world and the data that he collected provided science with a new field of study that is Evolutionary Biogeography. He made excellent discoveries in the evolution of different species all over the world during his land surveying explorations, which also helped give accurate maps of the Amazon and later on, the rest of the world.  
   During the explorations of Wallace he began to notice barriers that separated different species and began to see that these barriers were actually affecting the way those species evolved. On one of his land surveying trips he noticed that the Amazon river was a huge barrier and the species on one side or another were completely different. He began to notice and take note of these different traits that were happening due the different environments.
   Is it possible that Darwin could have made the same theory with out the help and correspondence of Alfred? He very well could have made the discovery with the info he received but there is no doubt it would have taken years and years longer to acquire the same info and data that Alfred had collected. Charles and Alfred came up with almost an identical theory, so it was clear Darwin already had the idea of how natural selection worked but it was Alfred who provided Charles with the data and collections that he came across. It would be unfair to over look Alfred Wallace and his contributions to Charles Darwin that help lead to his discoveries.
   The attitude of the church played a huge role on the decision for Darwin to release his findings. It was almost 20 years after his discovery that he made the decision to go ahead and publish his book on natural selection. If it wasn't for the motivation and support of Alfred it may have never been published. 

http://www.pewforum.org/2009/02/04/darwin-and-his-theory-of-evolution/